UNIVERSITY OF LJUBLJANA BIOTECHNICAL FACULTY ACADEMIC STUDY IN MICROBIOLOGY Eva WEBER AMMONIUM SOURCES FOR ARCHAEAL AND BACTERIAL AMMONIA OXIDISERS M. SC. THESIS Master Study Programmes: Field Microbiology Ljubljana, 2012
UNIVERSITY OF LJUBLJANA BIOTECHNICAL FACULTY ACADEMIC STUDY IN MICROBIOLOGY Eva WEBER AMMONIUM SOURCES FOR ARCHAEAL AND BACTERIAL AMMONIA OXIDISERS M. SC. THESIS Master Study Programmes: Field Microbiology VIRI AMONIAKA ZA AMONIAK-OKSIDIRAJOČE ARHEJE IN BAKTERIJE MAGISTRSKO DELO Magistrski študij - 2. stopnja Mikrobiologija Ljubljana, 2012
II This Master Sc. thesis is a completion of Master Study Programme in Microbiology. The work was carried out in the laboratory of microbiology in the School of Biological Sciences, University of Aberdeen (United Kingdom). Magistrsko delo je zaključek univerzitetnega študija 2. stopnje mikrobiologije na Biotehniški fakulteti Univerze v Ljubljani. Opravljeno je bilo v mikrobiološkem laboratoriju, School of Biological Sciences, Univerze v Aberdeenu (Velika Britanija) The Council of the 1. and 2. study cycle appointed Professor Ines Mandić Mulec, PhD, as a supervisor, Professor Jim I. Prosser, PhD, as a co-advisor and Assistant Proffesor Blaž Stres, PhD, as a reviewer. Komisija za študij 1. in 2. stopnje je za mentorico magistrskega dela imenovala prof. dr. Ines Mandić Mulec, za somentorja prof. dr. Jima I. Prosserja in za recenzenta doc. dr. Blaža Stresa. Advisor: Prof. Dr. Ines Mandić Mulec Co-advisor: Prof. Dr. Jim I. Prosser Reviewer: Assist. Prof. Dr. Blaž Stres Committee for evaluation and defence of Master Sc. thesis (komisija za oceno in zagovor): Chairman (predsednica): Prof. Dr. Romana Marinšek Logar University of Ljubljana, Biotechnical Faculty, Department of Animal Science Member (član): Prof. Dr. Ines Mandić Mulec University of Ljubljana, Biotechnical Faculty, Depatment of Food Science and Technology Member (član): Prof. Dr. Jim I. Prosser University of Aberdeen, School of Biological Sciences Member (član): Assist. Prof. Dr. Blaž Stres University of Ljubljana, Biotechnical Faculty, Department of Animal Science Date of defence (datum zagovora): Master Sc. thesis is the result of my own work. With this signature I agree with publication of this thesis in full text online. I declare that the electronic version is identical to printed version of this thesis. Magistrsko delo je rezultat lastnega raziskovalnega dela. Podpisana se strinjam z objavo svoje naloge v polnem tekstu na spletni strani Digitalne knjižnice Biotehniške fakultete. Izjavljam, da je naloga, ki sem jo oddala v elektronski obliki, identična tiskani verziji. Eva Weber
III KEY WORDS DOCUMENTATION DN Du2 DC UDC 579.266: 631.461: 582.233: 577.2.083 (043)=111 CX AU AA archaea/bacteria/microbial communities/ammonia-oxidising bacteria/ammonia-oxidising archaea/nitrification/ammonia/microcosms/soil microbiology/acidic soil/ph neutral soil/qpcr/dgge/flow injection analysis WEBER, Eva MANDIĆ MULEC, Ines (supervisor)/prosser, Jim I. (co-advisor)/stres, Blaž (reviewer) PP SI-1000 Ljubljana, Jamnikarjeva 101 PB PY 2012 TI DT NO LA AL AB University of Ljubljana, Biotechnical Faculty, Academic Study in Microbiology AMMONIUM SOURCES FOR ARCHAEAL AND BACTERIAL AMMONIA OXIDISERS M. Sc. Thesis (Master Study Programmes: Field Microbiology) XI, 62 p., 10 tab., 20 fig., 46 ref. en en/sl Until recently bacteria were thought to be the only organisms able to oxidise ammonia to nitrate, but the recent discovery of ammonia-oxidising archaea changed this belief. Furthermore recent evidence indicated that ammonia oxidising archaea (AOA) in acidic forest soil prefer organic sources of ammonium over inorganic sources. The aim of this thesis was to determine the influence of organic and mineral sources of ammonium on nitrification kinetics of AOA and ammonia oxidising bacteria (AOB) in two peat soils: an acidic forest peat soil (Bog) and an agricultural soil with neutral ph (Bevke). Nitrification was monitored in soil microcosms amended only once with glutamate and ammonium sulphate. A second experiment was performed in neutral soil microcosms which were repeatedly amended with glutamate or ammonium sulphate. After qpcr, DGGE and colorimetric analyses it was concluded that in acidic soil, AOA are in control of the nitrification and prefer an organic source of ammonium, but different sources of ammonium did not affect the growth or structure of AOA, in contrast to previously published data (Levičnik-Höfferle et al., 2012). In the neutral soil repeated amendment of organic source resulted in a faster nitrification rate along with a trend of increased AOB amoa abundance. Different sources of ammonium had no detectable effect on AOA or AOB communities in the neutral soil.
IV KLJUČNA DOKUMENTACIJSKA INFORMACIJA ŠD Du2 DK UDK 579.266: 631.461: 582.233: 577.2.083 (043)=111 KG AV SA arheje/bakterije/mikrobne združbe/amoniak-oksidirajoče bakterije/amoniakoksidirajoče arheje/nitrifikacija/amoniak/mikrokozmi/mikrobiologija tal/kisla tla/ph nevtralna tla/qpcr/dgge/pretočni spektrofotometer WEBER, Eva MANDIĆ MULEC, Ines (mentor)/prosser, Jim I. (somentor)/stres, Blaž (recenzent) KZ SI-1000 Ljubljana, Jamnikarjeva 101 ZA LI 2012 IN TD OP IJ JI AI Univerza v Ljubljani, Biotehniška Fakulteta, študij mikrobiologije VIRI AMONIAKA ZA AMONIAK-OKSIDIRAJOČE ARHEJE IN BAKTERIJE Magistrsko delo (Magistrski študij - 2. stopnja Mikrobiologija) XI, 62 str., 10 pregl., 20 sl., 46 vir. En en/sl Do nedavnega je prevladovalo mnenje, da so le AOB zmožne nitrifikacije, a pred kratkim so dokazali, da tudi arheje lahko oksidirajo amoniak in tako vršijo prvo stopnjo nitrifikacije. Poleg tega so nedavno pokazali, da v kislih gozdnih (šotnih) tleh AOA preferenčno oksidirajo organski viri amonijskega dušika pred anorganskimi viri. Cilj te magistrske naloge je bil preučiti vpliv organskega (glutamat) in anorganskega (amonijev sulfat) vira amoniaka na nitrifikacijsko hitrost ter na številčnost in sestavo AOA in AOB v talnih mikrokozmih. Kot referenčna tla smo uporabili kisla gozdna (Bog), ter nevtralno karbonatno polžarico s kmetijske površine (tla Bevke). V poskusu smo uporabili talne mikrokozme, katerim smo dodali vir amonijskega dušika bodisi dodali enkrat na začetku poskusa ali v drugem eksperimentu večkrat med samim poskusom. Na osnovi kolorimetričnih testov, qpcr in DGGE analiz smo zaključili, da so v kislih tleh AOA tiste, ki kontrolirajo nitrifikacijo in tudi preferenčno izrabljajo organski vir amonijaka, vendar slednji ni vplival na rast ali strukturo AOA, kar je je bilo v nasprotju z objavljenimi rezultati (Levičnik-Höfferle in sod., 2012). V nevtralnih kmetijskih tleh je večkratno dodajanje organskega vira amonijaka spodbudilo hitrost nitrifikacije, opažen je bil tudi trend povečanja števila AOB amoa genov. Različni viri amonijaka niso vplivali na strukturo AOA ali AOB v nevtralnih tleh.
V TABLE OF CONTENTS KEY WORDS DOCUMENTATION... III KLJUČNA DOKUMENTACIJSKA INFORMACIJA... IV TABLE OF CONTENTS... V LIST OF TABLES... VII LIST OF FIGURES... VIII ABBRIVATIONS AND SYMBOLS... X 1 INTRODUCTION...1 1.1 HYPOTHESIS AND OBJECTIVES...2 2 LITERATURE REVIEW...3 2.1 NITROGEN CYCLE AND NITRIFICATION...3 2.1.1 Nitrification and pollution...5 2.2 AMMONIA-OXIDISING BACTERIA...5 2.3 AMMONIA-OXIDISING ARCHAEA...8 2.4 WHO IS PERFORMING NITRIFICATION?... 12 3 MATERIALS AND METHODS... 17 3.1 MATERIALS... 17 3.2 METHODS... 19 3.2.1 Soil sampling... 19 3.2.1.1 Acidic soil (Bog)... 19 3.2.1.2 Neutral soil... 20 3.2.2 Determining the moisture content... 21 3.2.3 Soil microcosms... 22 3.2.3.1 Solutions used for the amendment of microcosms... 22 3.2.3.2 Experiment with single amendment... 23 3.2.3.3 Experiment with repeated amendment... 24 3.2.4 ph measurement... 25
VI 3.2.5 Nitrate and ammonium measurements... 25 3.2.6 Molecular assays... 25 3.2.6.1 DNA extraction... 25 3.2.6.2 Quantitative real-time PCR (qpcr)... 25 3.2.6.3 Denaturing gradient gel electrophoresis (DGGE)... 26 3.2.6.4 PCR programs and primers... 28 3.2.7 Statistical analysis... 31 4 RESULTS... 32 4.1 SOIL ph MEASUREMENTS...32 4.2 INFLUENCE OF AMMONIUM SOURCE ON NITRIFICATION RATE... 33 4.2.1 Experiment with single amendment... 33 4.2.2 Experiment with repeated amendment of ammonium sources... 35 4.3 ANALYSIS OF amoa GENE ABUNDANCE IN SOIL MICROCOSMS..39 4.4 DGGE ANALYSIS... 43 5 DISCUSSION... 45 5.1 ACIDIC SOIL (BOG)... 45 5.1.1 Activity in acidic soil... 45 5.1.2 Community structure in acidic soil... 46 5.2 NEUTRAL SOIL (BEVKE)... 46 5.2.1 Nitrification activity in neutral soil... 46 5.2.2 Community structure in neutral soil... 47 6 CONCLUSIONS... 48 7 SUMMARY... 49 7.1 POVZETEK... 51 8 LITERATURE... 58 AKNOWLEDGEMENTS
VII LIST OF TABLES Table 1: Summary of major properties and differences between Bacteria, Archaea and Eukarya (Madigan and Martinko, 2006)....8 Table 2: Molecular materials and suppliers... 17 Table 3: Electrophoresis and DGGE stock solutions and buffers... 18 Table 4: Primers used in the experiments... 28 Table 5: PCR program A... 29 Table 6: PCR program B... 29 Table 7: PCR program C... 29 Table 8: Program for qpcr of archaeal amoa genes... 30 Table 9: Program for qpcr of bacterial amoa genes... 30 Table 10: Nitrification rates calculated from (NO - 2 +NO - 3 )-N g -1 dry soil -1 concentrations, assuming that the nitrification rate is linear.... 37
VIII LIST OF FIGURES Figure 1: Major processes in the soil nitrogen cycle (Madigan and Martinko, 2006)....3 Figure 2: Classification of AOB and grouping in clusters as Purkhold et al. (2000) suggested. The cluster designations were adopted from Stephen et al. (1996) and two additional clusters were suggested....7 Figure 3: Archaeal tree of life from Woese s proposition to Brochier-Armanet s recent classification (Brochier-Armanet et al., 2008)... 10 Figure 4: Abundance of AOA and AOB amoa genes in all sampled soils (Leininger et al., 2006).... 11 Figure 5: Structural changes in AOA and AOB community (Nicol et al., 2008)... 14 Figure 6: Overall abundance of AOA and AOB amoa genes (A) and transcripts (B) (Nicol et al., 2008)... 15 Figure 7: Sampling site for the acidic soil marked with an arrow (a) (Google Earth, 2012) and the photograph of acidic soil (b).... 20 Figure 8: Sampling site for neutral soil marked with an arrow (a) (Google Earth, 2012) and the photograph of neutral soil (b).... 21 Figure 9: Scheme of the outline of the microcosm experiment with single amendment.... 23 Figure 10: Scheme of the outline of the microcosm experiment with repeated amendment... 24 Figure 11: ph of acidic soil (a) and ph of neutral soil (b) in experiment with single amendment... 32 Figure 12: ph measurements in neutral soil microcosms with repeated amendment.... 33 Figure 13: Accumulation of (NO - 2 +NO - 3 )-N g -1 dry soil in control microcosms (a), microcosms amended with ammonium sulphate (b) and microcosms amended with glutamate (c)... 38 Figure 14: Accumulation of NH 4 + -N g -1 dry soil (a) and (NO 2 - +NO 3 - )-N g -1 dry soil (b) in experiment with single amendment during incubation of microcosms with acidic soil... 34 Figure 15: Accumulation of NH 4 + -N g -1 dry soil (a) and (NO 2 - +NO 3 - )-N g -1 dry soil (b) during incubation in experiment with single amendment in microcosms with neutral soil. 35
IX Figure 16: Accumulation of NH 4 + -N g -1 dry soil (a) and (NO 2 - +NO 3 - )-N g -1 dry soil (b) during incubation in microcosms with neutral soil in experiment with repeated amendment... 36 Figure 17: AOA amoa gene abundance in acidic soil in experiment with single amendment for microcosms, amended with glutamate or ammonium sulphate or unamended control microcosms... 40 Figure 18: amoa gene abundance in neutral soil in experiment with single amendment for microcosms, amended with glutamate or ammonium sulphate or unamended control microcosms. Results are showed for AOA amoa gene abundance (a) and AOB amoa gene abundance (b)... 41 Figure 19: amoa gene abundance in neutral soil for microcosm experiment with repeated amendment of glutamate or ammonium sulphate or unamended control microcosms. Results are showed for AOA amoa gene abundance (a) and AOB amoa gene abundance (b)... 42 Figure 20: DGGE gels of AOA 16S rrna gene in acidic soil microcosms (a); thaumarchaeal amoa gene in acidic soil microcosms (b) and bacterial 16S rrna gene in neutral soil microcosms (c) in experiment with single amendment.... 44
X ABBRIVATIONS AND SYMBOLS 16S AMO amocab AOA AOB BOG C:N DGGE dh 2 O DNA N N 2 O NH 3 NH 4 + NH 4 + -N - NO 2 - NO 3 (NO - 2 +NO - 3 )-N qpcr rrna WHC Component of a small subunit of prokaryotic ribosomes Enzyme ammonia monooxygenase Ammonia monooxygenase encoding genes Ammonia-oxidising archaea Ammonia-oxidising bacteria Acidic forest peat soil Ratio between carbon and nitrogen Denaturing gradient gel electrophoresis Distilled water Deoxyribonucleic acid Elemental nitrogen Chemical symbol for nitrous oxide Chemical symbol for ammonia Chemical symbol for ammonium In the text as a concentration of ammonium nitrogen Chemical symbol for nitrite Chemical symbol for nitrate In the text as a total of nitrite and nitrate nitrogen Quantitative Real-time polymerase chain reaction Ribosomal ribonucleic acid Water holding capacity
1 1 INTRODUCTION Ammonia oxidation is the first step of nitrification and an important process within the nitrogen cycle performed by microorganisms. Understanding ammonia oxidation is important as a cause of environmental pollution and in agriculture, but the first question that must be answered is who is in control of ammonia oxidation? AOB were considered to be the only organisms involved in oxidation of ammonia to nitrite (Belser, 1979; Prosser, 1989) until the recent discovery that AOA could also oxidise ammonia (Könneke et al., 2005; Treusch et al., 2005) and are often more abundant in soil than AOB (Leininger et al., 2006; Prosser in Nicol, 2008). Research also showed that in the environments with low ammonia concentration such as unfertilised soil (Leininger et al., 2006) and soil with low ph (Stopnišek et al., 2010), where ammonia is released in soil from mineralisation of organic matter, AOA may have a selective advantage over AOB. In addition, Levičnik-Höfferle et al. (2012) showed that in soil with low ph, where AOA are more abundant, nitrification and ammonia oxidiser growth are stimulated by organic sources of ammonia, while inorganic ammonia has no effect. Although archaeal ammonia oxidation in soil with low ph is quite well researched, little is known of the relative activities of AOA and AOB, and the influence of different sources of ammonia, in soil with neutral ph, where both of the communities are equally represented. This was investigated using two soils from Ljubljana marsh. The marsh is one of the biggest of its kind in Slovenia with an area of approximately 150 km 2. Ljubljana marsh has various sediments and a water table that is very close to the surface. It has been declared as a Regional park with legal protection. This and its rich diversity of soil conditions make it ideally suited to investigation of soil microbial community structure and activity (Strokovne podlage za ustanovitev Krajinskega parka Ljubljansko barje, 2007; Kraigher et al., 2006).
2 1.1 HYPOTHESIS AND OBJECTIVES The main objective of this Master s thesis was to determine the effect of different sources of ammonium on ammonia oxidiser communities in soil with acid and neutral ph values. The study was based on the following objectives: In soil with low ph, where only AOA are present, organic sources of ammonia are preferred and result in a higher nitrification rate, faster growth, greater transcriptional activity of AOA and changes in AOA community structure. In soil with neutral ph, where both AOA and AOB are present: o Amendment with inorganic ammonium will increase AOB growth and activity and change AOB community structure, but will not affect the AOA community. o Amendment with mineralisable organic nitrogen will stimulate AOA growth and activity, and change AOA community structure, but will not influence AOB.
3 2 LITERATURE REVIEW 2.1 NITROGEN CYCLE AND NITRIFICATION Nitrogen is an important element for all living organisms, since it is a component of nucleic acids and proteins. Around 78% of all available nitrogen is in the atmosphere and therefore unavailable for biological activity. Other large pools of nitrogen can be found in soil in various forms as it is transformed in the nitrogen cycle, mainly through microbial activity. The cycle itself has five major reactions in which nitrogen compounds are oxidised or reduced. They are shown below in figure 1. Figure 1: Major processes in the soil nitrogen cycle (Madigan and Martinko, 2006) Slika 1: Shema kroženja dušika v tleh s predstavljenimi glavnimi reakcijami (Madigan in Martinko, 2006) Nitrification consists of two processes. In the first process, ammonia oxidised to nitrite. For AOB, this is achieved through conversion of ammonia to hydroxylamine, by the enzyme ammonia monooxygenase (AMO), and subsequent conversion to nitrite, by hydroxylamine oxidoreductase: NH 3 + O 2 + 2H + + 2e - NH 2 OH + H 2 O (1)
4 NH 2 OH + H 2 O NO 2 + 5H + + 4e - (2) In the second reaction, nitrite is oxidised further to nitrate (NO 3 - ) by the enzyme nitrite oxidoreductase: NO 2 - + H 2 O NO 3 - + 2H + + 2e - (3) AOA also possess ammonia monooxygenase but genome analysis provides no evidence for genes homologous to hydroxylamine oxidoreductase (Walker et al., 2010). This suggests a different pathway for ammonia oxidation by AOA that does not involve hydroxylamine as an intermediate. Details of this metabolic pathway in AOA are currently not characterised. In natural environments, ammonia oxidisers can be detected by amplification of 16S rrna genes or genes encoding AMO (Rotthauwe et al., 1997). AMO is encoded by three genes, amocab. amoa and amob genes encode subunits A and B, while amoc gene encodes a third enzyme subunit that is more stable than the other two (Arp et al., 2002). Rotthauwe et al. (1997) suggested targeting the amoa gene for detection of ammonia oxidisers. This became a leading molecular tool for detecting AOB and AOA for its specificity, good resolution and for detecting functional property of microorganism instead of phylogenetic one. The substrate for nitrification is ammonia (NH 3 ), rather than ammonium (NH + 4 ). NH 3 is uncharged and is therefore not bound to negatively charged soil particles. Although ammonia can be leached from soil, or lost through volatilisation, ammonia and ammonium (NH + 4 ) are in equilibrium. Ammonium is positively charged, can bind to soil particles and is available to both plants and microorganisms as a source of nitrogen (Suzuki et al., 1974). The product of nitrification, nitrate, is negatively charged and not adsorbed by soil particles (Figure 1). Although it can also provide a source of nitrogen to plants, it is lost from soil through leaching and can also act as a substrate for denitrification, through which it is converted into nitrous oxide (N 2 O), a greenhouse gas with a negative effect on the environment, or nitrogen gas. Research on nitrification is therefore crucial for agriculture, as it is important to manage fertiliser loss, and for the environmental reasons, as nitrous oxide is an atmospheric pollutant, and nitrate pollutes groundwater. If soil is fertilised for a long period of time, the C:N ratio in soil can change with increased inorganic N, therefore it is important to determine how much of N fertilisers can be applied for an
5 environmentally safe agriculture (Madigan and Martinko, 2006; Kowalchuk and Stephen, 2001; Raun et al., 1998). 2.1.1 Nitrification and pollution Humans have influenced the natural nitrogen cycle by adding significant amounts of reactive-n to various ecosystems, through fertiliser addition and atmospheric nitrogen deposition. Soil nitrifiers convert fertiliser ammonium to nitrate and, even though plants can assimilate nitrate as well as ammonium, much of the nitrate leaches into groundwater or is converted to nitrogen or greenhouse gases, NO and N 2 O. A solution to this problem is in controlled nitrification. Unsupervised addition of fertilisers generates a rapid nitrifying soil (Subbarao et al., 2012). As a result a large amount of effort has been made to regulate nitrification in soil in order to prevent fertiliser loss. This includes development of a range of nitrification inhibitors. Acetylene was the first nitrification inhibitor to be found and was followed by others such as mechanism-based inhibitors, S compounds and heterocyclic compounds used in soil and are industrially made (McCarty, 1999). Another more recent solution to controlling nitrification is use of biological inhibitors of nitrification. These are compounds released by plants that inhibit nitrifying microorganisms. For example, Subbarao et al. (2006) discovered a nitrification inhibitor that is produced by roots of Brachiaria humidicola plant. They used a bioluminescence assay to evaluate whether different plants can produce biological nitrification inhibitors but as this utilised only one test organism, N. europaea, it is still unconfirmed whether biological nitrification inhibitors are suitable for other nitrifying microorganisms. Nitrification can also be inhibited by atmospheric pollutants, e.g. heavy metals and hydrocarbons. These pollutants have a negative effect on nitrification, reducing nitrification rates in polluted soils (Christensen et al., 2001; Nevell and Wainwright, 1987). A possible application of this finding is that nitrification could be used as a pollution indicator (Christensen et al., 2001). 2.2 AMMONIA-OXIDISING BACTERIA AOB are obligate aerobic microorganisms even though some like Nitrosomonas europaea can tolerate anaerobic conditions and can even denitrify (Geets et al., 2006). Their
6 substrate is acknowledged to be ammonia and not ammonium, whose retention in soil is greater in most soils, because of adsorption of ammonium ions to soil particles (Kowalchuk and Stephen, 2001). Some AOB species can grow in the environment with urea as a source of ammonia, even though it was thought that AOB are unable to grow with organic source of nitrogen. That is achieved by hydrolysis of urea to ammonia, which is then oxidised (Jiang et al., 1999). Initially all nitrifying bacteria were classified in a single group, belonging to the family Nitrobacteraceae (Watson, 1989), but classification based on 16S rrna analysis led to separation of ammonia-oxidising bacteria and nitrite-oxidising bacteria. Autotrophic AOB were placed in three subclasses within the betaproteobacteria and gammaproteobacteria (Kowalchuk and Stephen, 2001). Woese (1987) already divided AOB in two groups of beta-purple bacteria and gammapurple bacteria following 16S rrna gene sequence analysis. Stephen et al. (1996) further determined that Nitrosococcus halophilus and Nitrosococcus oceanis belong to the gammaproteobacteria, while Nitrosomonas spp. and Nitrosospira spp. belong to a group of betaproteobacteria. They also suggested that N. europaea and Nitrosococcus mobilis should be combined in a single phylogenetic group, based on similarities in 16S rrna gene sequences. Altogether they divided beta-subclass AOB into 7 clusters. Purkhold et al. (2000) confirmed these findings with phylogenetic analysis of 16S rrna sequence and suggested additional clusters. The difference in classification can be seen in figure 2.
7 Figure 2: Classification of AOB and grouping in clusters as Purkhold et al. (2000) suggested. The cluster designations were adopted from Stephen et al. (1996) and two additional clusters were suggested Slika 2: Klasifikacija AOB in združenje v skupke, kot predlaga Purkhold in sod. (2000). Oblikovanje v skupke je bilo povzeto po Stephen in sod. (1996) s predlaganimi dvema dodatnima skupkoma
8 2.3 AMMONIA-OXIDISING ARCHAEA Even before archaea were recognised as a separate domain, it was known that their properties were not consistent with the universal description of the prokaryota domain (Table 1). Finally after Woese's proposal (Woese et al., 1990) of the third domain of life, the world of science changed. Archaeobacteria were not part of bacterial domain, but were classified separately, as Archaea. There was still a belief, however, that archaea were extremophiles, since they were only found in extreme environment, such as hot springs and volcanoes (Woese et al., 1990). Table 1: Summary of major properties and differences between Bacteria, Archaea and Eukarya (Madigan and Martinko, 2006) Preglednica 1: Glavne razlike med tremi domenami: Bacteria, Archaea in Eukarya. (Madigan in Martinko, 2006) Characteristic Bacteria Archaea Eukarya Prokaryotic cell structure Yes Yes No DNA in covalently closed and circular form Yes Yes No Histone proteins No Yes Yes Cell wall (present muramic acid) Yes No No Membrane lipids Ester-linked Ether-linked Ester-linked Ribosome (mass) 70S 70S 80S Introns in most genes No No Yes Transcriptional factors required No Yes Yes Promoter structure -10 and -35 sequence TATA box TATA box Initiator trna Formylmethionine Methionine Methionine In 1992 two research groups (DeLong, 1992; Fuhrman, 1992) showed that archaea also exist in cold seawater. Fuhrman (1992) discovered archaea in marine plankton 100 m and 500 m below the surface. They reported new sequences that were only distantly related to
9 those of extremophiles and suggested that the new 16S rrna gene sequences were archaeal, even though they had never before been detected in the sea. DeLong (1992) also discovered mesophilic archaea in oxic surface coastal seawater and therefore confirmed the existence of a new archaeal phylum, the Crenarchaeota. Following further discoveries of mesophilic Crenarchaeota, Brochier-Armanet et al. (2008) compared hyperthermophilic Crenarchaeota and newly discovered mesophilic archaea. Since there are differences between the two it was not appropriate to classify them under the same phylum and they proposed a third phylum called Thaumarchaeota (Figure 3). Ochsenreiter et al. (2003) analysed DNA extracted from soil samples with specific primers for non-thermophilic Crenarchaeota. 16S rrna genes were targeted and it was discovered their presence in different types of soil, where they formed a stable and abundant community. Later Kemnitz et al. (2007) confirmed the presence of archaea in a range of mesophilic environments. Further studies of the archaea:bacteria ratio in soil samples demonstrated a higher percentage of bacterial 16S rrna genes, but a significant and stable proportion of archaeal sequences. Within the crenarchaeota, the most abundant fell within the 1.1c group in the studied soil, but the numbers decreased with depth. In a soil metagenome study, Treusch et al. (2005) identified a fosmid, 54d9, from a library prepared from sandy soil ecosystem. With 16S rrna analysis it was determined that the fragment was affiliated with 1.1b group of Crenarchaeota and also contained amoab genes but not amoc; amoa-like genes were found at even higher abundance in the soil after amendment with ammonia. Similar genes were also found in an environmental library from the sea plankton. In conclusion this study suggests that mesophilic archaea are present in terrestrial and marine environments and are capable of oxidising ammonia. Könneke et al. (2005) then isolated an aerobic autotrophic ammonia-oxidising archaea again in marine samples. This discovery shook the scientific world as it was thought that only bacteria were capable of oxidising ammonia. After comparing archaeal and bacterial amoa genes it was discovered that they differed in structure, but were sufficiently similar to conclude that AOA have an important role in nitrogen cycle (Nicol and Schleper, 2006). Since then AOA have been discovered in many different environments, but it seems that they are mainly found in soil and marine samples. In soil samples Leininger et al. (2006)
10 determined AOA and AOB amoa gene abundance and concentration of archaea specific lipids in soil. The results were fascinating as they showed that AOA are more abundant than AOB in soil and the ratio of AOA to AOB increased with depth and in non-fertilised soil (Figure 4). The statement that AOA are more abundant than AOB in some soils triggered the question: Who contributes more to the nitrification process; AOA or AOB? Figure 3: Archaeal tree of life from Woese s proposition to Brochier-Armanet s recent classification (Brochier-Armanet et al., 2008) Slika 3: Filogenetsko drevo arhej od prvotne oblike, ki jo je predlagal Woese, do končnega Brochier- Armanetovega predloga (Brochier-Armanet in sod., 2008)
11 Figure 4: Abundance of AOA and AOB amoa genes in all sampled soils (a). Ratio of AOA to AOB with increasing depth (b,c) (Leininger et al., 2006) Slika 4: Številčnost AOA in AOB amoa genov v vseh vzorčenih tleh (a). Razmerje AOA proti AOB z globino tal (b,c) (Leininger in sod., 2006)
12 2.4 WHO IS PERFORMING NITRIFICATION? Who is performing the nitrification, and under what conditions, are the leading questions to many researchers active in the field of nitrification. After several studies measuring AOA or AOB amoa abundance in different types of soil it became clear that several factors might determine their relative numbers (Prosser and Nicol, 2012). Jia and Conrad (2009) amended agricultural soil microcosms with ammonium and prevented acidification due to nitrification by liming, ensuring that soil remained at neutral ph. AOA and AOB amoa gene abundance was measured and community structure was determined by denaturing gradient gel electrophoresis (DGGE). Even though AOA outnumbered AOB, the latter were more active and performed most of the nitrification following addition of ammonium. This was demonstrated by inhibiting nitrification by adding acetylene to microcosms and observing nitrification kinetics. Acetylene is an inhibitor of nitrification and therefore inhibits growth and transcriptional activity of the community that controls nitrification. In this study acetylene affected only AOB and not AOA. The conclusion was that AOA were not significantly important in ammonia oxidation in the examined agricultural soil. In contrast, Gubry-Rangin et al. (2010) demonstrated the importance of AOA in an acidic agricultural soil. Again relative abundance of amoa gene was determined for both AOA and AOB and community structure was observed using DGGE. The soil used was a Scottish acidic agricultural soil with ph 4.5 and 6. To confirm which community controls nitrification, microcosms were amended with acetylene as described before. Observing only nitrification kinetics brought no conclusion, as the rates were high for both soils in the absence of acetylene and low in its presence. However, analysis of population growth showed that AOA grew faster than AOB. In the presence of acetylene, growth of AOA decreased significantly, as well as transcriptional activity, but acetylene had no significant influence on the AOB community. This study therefore provided strong evidence that AOA contributed significantly to nitrification in this acidic soil. These studies suggested that ph may influence the relative contributions of AOA and AOB to nitrification. Nicol et al. (2008) discovered that community structure of both AOA and AOB differed in acidic and neutral soil plots (Figure 5). They also determined amoa gene
13 abundance for both communities and while AOA had greater growth and activity than AOB, an influence of ph was observed. With increasing ph from 4.9 to 7.5, AOA growth and activity decreased, while an increase was observed for AOB (Figure 6). They also mixed sampled soil with adjusted ph and it was concluded that the community controlling nitrification in its native soil was the most successful at the ph that it was adapted to. These results suggested distinct ecological niches for AOA and AOB. Tourna et al. (2008) showed that temperature is another factor influencing AOA communities. It had an effect on nitrification kinetics and community structure. Interestingly only AOA community changed with increasing temperature from 10 C to 30 C, and this change does not influence AOB community.
14 Figure 5: Structural changes in AOA and AOB community as shown by Nicol et al. (2008). Statistically significant changes in community can be seen from the gels with increasing ph Slika 5: Strukturne spremembe združb AOA in AOB, kot so prikazali Nicol in sod. (2008). Statistično značilne spremembe so opazne z višanjem ph vrednosti
15 Figure 6: Overall abundance of AOA and AOB amoa genes (A) and transcripts (B). Decreasing abundance in the AOA community can be observed with increased ph and increasing abundance in the AOB community (Nicol et al., 2008) Slika 6: Številčnost AOA in AOB amoa genov (A), ter njihovih transkriptov (B) s spreminjanjem ph. Z zviševanjem ph vrednosti se zmanjša številčnosti amoa gena in transkripta gena pri AOA združbi. AOB združba se z zviševanjem ph obnaša ravno obratno (Nicol in sod., 2008) There is another important factor that can determine whether AOA or AOB will control nitrification. Because of their different physiologies they can adjust to different circumstances. Stopnišek et al. (2010) studied acidic forest peat soil with ph 4.1 that has low ammonia concentration, but high potential for acquiring substrate produced through mineralisation. AOB amoa genes could not be detected, suggesting a selective advantage of AOA over AOB in this soil. AOA amoa genes increased in abundance during nitrification, but amendment of microcosms with ammonia had no influence on growth, nitrification rate or AOA community structure. This suggests that AOA in acidic soil get
16 their source of nitrogen through mineralisation and do not respond to added inorganic source of nitrogen. A subsequent study by Levičnik-Höfferle et al. (2012) tested the hypothesis that AOA prefer organic source of nitrogen using the soil investigated by Stopnišek et al. (2010). Levičnik-Höfferle et al. (2012) tested the influence of organic and inorganic source of nitrogen in this soil. Nitrification rate was stimulated by addition of an organic source of nitrogen, but did not differ from the control (microcosms amended with water) when amended with inorganic nitrogen. Increased amoa gene abundance was observed in microcosms amended with organic nitrogen, but did not change with the amendment of inorganic source of nitrogen. This research showed the importance of source of nitrogen for ammonia oxidisers. In conclusion, these studies indicate that no single factor determines whether AOA or AOB control nitrification in soil. Every study was dealing with different physiology and large diversity. This makes it difficult to predict conditions under which the different communities will predominate, but one factor is clear. All the studies showed adaptation of AOA to ph lower than 5.5, but not AOB. This makes it clear that only AOA can oxidise ammonia under this conditions (Prosser and Nicol, 2012).
17 3 MATERIALS AND METHODS 3.1 MATERIALS Table 2: Molecular materials and suppliers Preglednica 2: Materiali za molekularne metode in proizvajalci Material General laboratory materials Agarose (molecular grade) BIOPRO DNA polymerase Deoxyribonucleotides (datp, dctp, dgtp and dttp) Hyperladder I DNA size and mass ladder NucleoSpin Extract II (DNA purification kit) Quiagen RNA/DNA Purification kit Quantitect SYBR Green PCR kit Quantifast SYBR Green PCR kit Oligonucleotides MO-BIO Powersoil DNA Isolation kit GelBond PAG film for polyacrylamide gels Supplier BDH-Merc, Leicestershire, UK Fisher Scientific, Leicestershire, UK Oxoid, Hampshire, UK Sigma-Aldrich, Dorset, UK Bioline Ltd., London, UK Macherey-Nagel, Düren, Germany Quiagen, West Sussex, UK Thermo Electron Coporation, Ulm, Germany Carlsbad, CA USA Amersham Bioscineces AB, Uppsala, Sweden
18 Table 3: Electrophoresis and DGGE stock solutions and buffers Preglednica 3: Založne raztopine in pufri za elektroforezo in DGGE Solution or buffer TAE 50 6x loading buffer Acrylamide solution 0% denaturant Acrylamide solution 80% denaturant Fixing solution (for DGGE) Staining solution (for DGGE) Developing solution (for DGGE) Ingredients for the solution or buffer 242 g Tris; 57.1 ml Glacial acetic acid;100 ml 0.5 M EDTA (ph 8.0); dh 2 O to 1 l 0.25% Bromophenol blue; 0.25% Xylene cyanol; 30% Glycerol 2 ml 50 TAE; 20 ml 40% 37:1 acrylamidebisacrylamide; dh 2 O to 100 ml 2 ml 50 TAE; 20 ml 40% 37:1 acrylamidebisacrylamide; 33.6 g Urea; 32 ml Formamide; dh 2 O to 100 ml 100 ml Ethanol; 5 ml Glacial acetic acid; 859 ml dh 2 O 0.3 g AgNO 3 ; 300 ml dh 2 O 6 g NaOH; 3 ml 40% Formaldehyde; 200 ml dh 2 O
19 3.2 METHODS 3.2.1 Soil sampling Two different soils were used for this experiment. The first soil (termed Bog soil or acidic soil) is a forest peat soil with low ph (4.3), high organic content and high C:N ratio (Stopnišek et al., 2010). The second soil (Bevke or neutral soil) is carbonated snail soil that is a residue of sediment that has been exposed to higher layers due to digging of the drainage canals. Addition of the alkaline snail soil over the peat soil resulted in mixing of both soil, an increase in soil ph (7.5) and a decrease in organic content (Štrubelj, 2010). A different approach was used in sampling because of these structural differences between two soils 3.2.1.1 Acidic soil (Bog) Soil with low ph was collected in Kozlar s deciduous forest; coordinates for sampling site are 45 59'34.68"N and 14 30'8.60"E (refer to figure 7). Soil was collected from 3 sampling sites, each separated by 5 m. On each sampling site 5 random samples were collected from the upper 20 cm of the soil layer using a corer. The soil was then sieved through an 8 mm sieve instead through 4 mm sieve due to high organic content and consequently heavy clumping. Approximately 4 kg of soil was collected.
20 a) b) Figure 7: Sampling site for the acidic soil marked with an arrow (a) (Google Earth, 2012) and the photograph of acidic soil (b). Slika 7: Mesto vzorčenja za kisla tla označeno s puščico v Kozlarjevem gozdu (a) (Google Earth, 2012) in slika kislih tal (b). 3.2.1.2 Neutral soil Agricultural soil with neutral ph was collected in Bevke, from an unvegetated field in December 2011, and from the same field, but with vegetation, in May 2012. The coordinates for the sampling site are 46 0'5.04"N and 14 22'1.50"E (refer to figure 8). Each time the soil was collected on 3 randomly chosen sampling sites. The upper 10 cm of soil was collected, as described above, since this type of soil accumulated at the upper layers of the field. 4 kg was collected and sieved through 4 mm sieve.
21 a) b) Figure 8: Sampling site for neutral soil marked with an arrow (a) (Google Earth, 2012) and the photograph of neutral soil (b). Slika 8: Mesto vzorčenja za nevtralna tla označeno s puščico, pri vasi Bevke (a) (Google Earth, 2012) in slika nevtralnih tal (b). 3.2.2 Determining the moisture content Moisture content was determined to enable calculation of soil characteristics per g of dry soil. It was determined for experiment with single amendment by drying at 60 C for three days. Moisture content was calculated as: Moisture content = mg(h 2 O)/mg(dry soil) (5) % Moisture content for neutral soil was 58.8% and for acidic soil it was 53.2%. For experiment with repeated amendment, percentage of moisture content was measured using a Moisture Analyser Balance Ohaus MB45 (Thomson Science) and was 35% moisture content.
22 3.2.3 Soil microcosms 3.2.3.1 Solutions used for the amendment of microcosms a) Experiment with single amendment using acidic and neutral soil. Glutamate, ammonium sulphate or water were added to the microcosms at day 0 a. Ammonium sulphate and glutamate (150 µg N g -1 dry soil) solutions for neutral soil (1 ml was added to each microcosm) b. Ammonium sulphate and glutamate (150 µg N g -1 dry soil) solutions for acidic soil (3 ml was added to each microcosm) b) Experiment with repeated amendment using neutral soil, that was amended with glutamate, ammonium sulphate or water at day 0, 3, 6, 11, 16, 18 and 21 a. Ammonium sulphate and glutamate (100 µg N g -1 dry soil) solutions for continuous amendment (1 ml was added to each microcosm) 1 Ammonium sulphate and glutamate were chosen as previously described by other publications (Stopnišek et al., 2010; Levičnik-Höfferle et al., 2012). 1 1 ml of solutions was added only on day 0. For continuous amendment loss of moisture was determined and the solutions were prepared accordingly. Concentration of solutions stayed the same (100 µg N g -1 dry soil).
23 3.2.3.2 Experiment with single amendment Figure 9: Scheme of the outline of the microcosm experiment with single amendment. On day 0; soil microcosms with 150 µg N g -1 dry soil of ammonium sulphate or glutamate. In control microcosms, water was added instead. White squares represent control, yellow squares represent ammonium sulphate microcosms and red squares represent glutamate microcosms. Large brown squares represent sampled soil. Each square represents three repetitions. Microcosms were sampled destructively on days 0, 4, 7, 10, 20 and 30. The same outline was used for acidic and neutral soils. Slika 9: Shematski prikaz mikrokozemskega eksperimenta z enkratnim dodajanjem dodatkov. Rjavi kvadrati predstavljajo tla, ki smo jih vzorčili. Beli kvadrati predstavljajo kotrolo, kjer smo dodali deionizirano vodo; z rumeno barvo so označeni mikrokozmi, kjer smo dodali 150 µg N g -1 suhih tal amonijevega sulfata; rdeča barva pa označuje mikrokozme kjer smo dodali 150 µg N g -1 suhih tal glutamata. Dodatke smo v mikrokozme dodali ob dnevu 0. Vsak kvadrat predstavlja tri ponovitve. Uporabili smo destruktivno vzorčenje ob dnevih 0, 4, 7, 10, 20 in 30. Enaka struktura poskusa velja tako za kisla tla, kot tudi za nevtralna tla. For the first experiment, the microcosms consisted of glass bottles, with rubber caps, containing 30 g of soil and were amended either with ammonium sulphate or glutamate, to the final concentration of 150 µg N g -1 dry soil. In control microcosms, water was added instead. Microcosms were weighted throughout the experiment to control the water evaporation. The appropriate amount of distilled water was replaced then in all microcosms. Microcosms were destructively sampled after incubation at 28 C for 0 (immediately after amendment), 4, 7, 10, 20 and 30 days. On each sampling day 10 g of soil was used for KCl extraction, 5 g was used for ph measurement and remaining soil was stored in plastic bags at -80 C.
24 3.2.3.3 Experiment with repeated amendment Figure 10: Scheme of the outline of the microcosm experiment with repeated amendment with 100 µg N g -1 dry soil, to ammonium sulphate and glutamate microcosms on days 0, 4, 6, 11, 16, 18 and 21. In control microcosms, water was added instead. White squares represent control, yellow squares represent ammonium sulphate microcosms and red squares represent glutamate microcosms. Large brown squares represent sampled soil. Each square represents three repetitions. Microcosms were destructively sampled on days 0, 3, 6, 9, 12, 15, 18, 21 and 24. Only neutral soil was used in this experiment. Slika 10: Shematski prikaz mikrokozemskega poskusa s ponavljajočim dodajanjem amonijevih spojin. Rjavi kvadrati predstavljajo vzorčena tla. Beli kvadrati predstavljajo kontrolo, kjer smo dodali deionizirano vodo; z rumeno bravo so označeni mikrokozmi, kjer smo dodali amonijev sulfat; rdeča barva pa označuje mikrokozme kjer smo dodali glutamat. Dodatke smo mikrokozmom dodajali ob dnevih 0, 4, 6, 11, 16, 18 in 21. Dodali smo 100 µg N g -1 suhih tal. Vsak kvadratek predstavlja tri ponovitve. Ob dnevih 0, 3, 6, 9, 12, 15, 18, 21 in 24 smo uporabili destruktivno vzorčenje. Pri tem poskusu smo uporabili le nevtralna tla. For the second experiment, microcosms consisted of glass bottles, with loose fitting caps, containing 15 g of neutral soil and were amended with ammonium sulphate or glutamate to the final concentration of 100 µg N g -1 dry soil. Microcosms were amended with an additional 100 µg µg N g -1 dry soil on days 0, 4, 6, 11, 16, 18 and 21. Because of evaporation, after each destructive sampling all of the remaining microcosms were weighted and adequate amount of distilled water (with source of ammonia for ammonium sulphate and glutamate microcosms) was replaced. Microcosms were destructively sampled after incubation at 28 C for 0, 3, 6, 9,12,15,18, 21, and 24 days; sampled soil was
25 placed into plastic bags and stored at -20 C. KCl extraction and ph measurements were performed after all microcosms were sampled. 3.2.4 ph measurement ph was measured after each destructive sampling. In the falcon tubes 10 ml of distilled H 2 O was added to 5 g of the collected soil. Falcon tubes were incubated at the room temperature for 30 min. ph was then measured using InoLAB ph/cond 720 (WTW GmbH) 3.2.5 Nitrate and ammonium measurements Nitrate and ammonium concentrations in KCl soil extracts were determined colorimetrically using flow injection analysis (FIA star 5000 Analyzer, Foss Tecator). To 10 g of soil, 50 ml of 2M KCl (Fisher, analytical gradient) was added and placed on a rotator (Rotator drive STR4, Stuart) for 1 hour. After 15 min centrifugation at 3000 g, supernatant was collected and analysed. Standards in range from 0.1 µm to 5 µm were used and samples for nitrification measurements were diluted in ratio 1:11. Nitrification rate was calculated separately for each experiment by linear regression of increases and decreases in nitrate + nitrite and ammonium concentration, respectively. 3.2.6 Molecular assays 3.2.6.1 DNA extraction DNA was extracted from 0.25 g of soil, using MO-BIO PowerSoil DNA isolation kit. The vortexing step was modified by fixing samples to the Vortex genie 2 (Scientific Industries) and samples were vortexed for 15 min on speed 8. DNA was eluted with 100 µl of elution buffer and later aliquoted into 4 eppendorf tubes. The concentration of DNA was then measured spectrophotometrically with NanoDrop (Thermo Scientific). Tubes were stored at -20 C and -80 C. 3.2.6.2 Quantitative real-time PCR (qpcr) Standards for qpcr were prepared from DNA extracted from pure cultures; Nitrosospira multiformis for AOB and Nitrosotalea devanaterra for AOA. For AOB assays, the targeted
26 fragment was amplified using PCR program B (Table 6) with primers AOB-amoC-F and AOB-amoB-R. For AOA nested PCR programs A and C were used (Table 5); with Ndevamo-f1, Ndev-amo-f2 and Ndev-amo-r10 sets of primers. DNA for standards was diluted to 10 9 copies per qpcr reaction and dilutions of standards from 10 8 to 10 1 copies per reaction were then made. qpcr of archaeal amoa gene was performed in 25 µl volume containing 10 µl Quantitect SYBER Green Master Mix (Qiagen), 1.5 µm of each primer (CrenamoA23f and CrenamoA616r), 0.2 µm of bovine serum albumin (BSA) and 5 µl of DNA extract, as indicated in Table 8. Three replicates were used for each time point. Negative template control was used in two replicates, with cycle threshold (Ct) value higher that the Ct value of 10 1 copies of standard. For qpcr of bacterial amoa genes, each reaction was performed in a 25 µl volume containing 12.5 µl Quantifast SYBER Green Master Mix (Qiagen), 0.4 µm of each primer (amoa-1f and amoa-2r), 0.2 µm of bovine serum albumin (BSA) and 5 µl of DNA extract, as indicated in Table 9. Three replicates were used for each time point. Negative template control was used in two replicates, with cycle threshold (Ct) value higher that the Ct value of 10 1 copies of standard. All results with negative template controls were then checked with gel electrophoresis using 2% agarose gel (Bioline, molecular grade) and 100 V. A standard Hyperladder I (Bioline) was used. Gels were stained with 5% ethidium bromide and checked under the UV light (HP System, AlphaImager). 3.2.6.3 Denaturing gradient gel electrophoresis (DGGE) DGGE analysis with DCode Universal Mutation Detection (Bio-Rad) was used to determine changes within the archaeal or bacterial communities. Specific primers with attached GC-clamp for amoa gene and 16S rrna gene were used to increase the separation of bands in the gel. For 16S rrna gene, a nested PCR strategy was used and for archaeal amoa gene, primers without GC-clamp were used (Table 6; Table 7). DGGE for bacterial amoa gene was not performed. All the primers used for DGGE are described in Table 4.
27 Gels were made using the method described previously by McCaig et al. (2001). They contained 8% polyacrylamide that was polymerised with addition of 0.1% ammonium persulfate and 0.01% TEMED solution. For 16S rrna and amoa genes, 35%-75% and 15%-55% gradients of denaturant were used respectively. Gels were poured using Miniplus3 Peristaltic pump (Gilson). For electrophoresis 7 l of 1 TAE buffer were heated to a constant 60 C temperature. Electrophoresis ran for 960 min and 75 V under these conditions. Afterwards the gels were placed in a fixing solution for 30 min and stained with the silver staining method (Nicol et al., 2005). Gels were then scanned with Epson GT-9600 (Epson) scanner.
28 3.2.6.4 PCR programs and primers Table 4: Primers used in the experiments Preglednica 4: Začetni oligonukleotidi, uporabljeni pri magistrski nalogi Primers Sequence 5' - 3' Reference AOB amoa genestandard AOB-amoC F GTCGTTTGGAACRGCARAGCAAA Unpublished AOB-amoB R AOA amoa genestandard TCCCAGCTKCCGGTRATGTTCATCC Unpublished Ndev-amo-f1 GTTTTCACTAGATGACTTAG Unpublished Ndev-amo-f2 GAAAAGAGAGGGGGTGATGATTG Unpublished Ndev-amo-r10 GATTTAGTCCCACTTAGACC Unpublished AOA amoa gene CrenamoA23f ATGGTCTGGCTWAGACG Tourna et al., 2008 CrenamoA616r GCCATCCATCTGTATGTCCA Tourna et al., 2008 AOB amoa gene amoa-1f GGGGTTTCTACTGGTGGT Rotthauwe et al., 1997 amoa-2r CCCCTCKGSAAAGCCTTCTTC Rotthauwe et al., 1997 Bacterial 16S rrna gene CTO189fa GGAGRAAAGCAGGGGATCG Kowalchuk et al., 1997 CTO189fc GGAGGAAAGTAGGGGATCG Kowalchuk et al., 1997 CTO654r CTAGCYTTGTAGTTTCAAACGC Kowalchuk et al., 1997 MF (Muyzer) -GC clamp CCTACGGGAGGCAGCAG-GC clamp Muyzer et al., 1993 MR (Muyzer) ATTACCGCGGCTGCTGG Muyzer et al., 1993 Archaeal 16S rrna gene A109f ACKGCTCAGTAACACGT Großkopf et al., 1998 1492R-GN GYYACCTTGTTACGACTT Nicol et al., 2008 771F ACGGTGAGGGATGAAAGCT Ochsenreiter et al., 2003 957R-GC clamp CGGCGTTGACTCCAATTG-GC clamp Ochsenreiter et al., 2003 Y = T or C, K = G or T, M = A or C, W = A or T, R = G or A
29 Table 5: PCR program A Preglednica 5: PCR program A Step Temperature Time Number of cycles Initial denaturation 95 C 5 min 1 Denaturation 95 C 30 s Annealing 45 C 30 s Elongation 72 C 3 min 35 Extension 72 C 10 min 1 Table 6: PCR program B Preglednica 6: PCR program B Step Temperature Time Number of cycles Initial denaturation 95 C 5 min 1 Denaturation 94 C 30 s Annealing 55 C 30 s Elongation 72 C 1 min 35 Extension 72 C 10 min 1 Table 7: PCR program C Preglednica 7: PCR program C Step Temperature Time Number of cycles Initial denaturation 95 C 5 min 1 Denaturation 94 C 30 s 10 Annealing 55 C 30 s Elongation 72 C 30 s Denaturation 92 C 30 s 25 Annealing 55 C 30 s Elongation 72 C 30 s Extension 72 C 10 min 1
30 Table 8: Program for qpcr of archaeal amoa genes Preglednica 8: qpcr program za arhejski amoa gen Step Temperature Time Number of cycles Initial denaturation 95 C 15 min 1 Denaturation 94 C 20 s Annealing 55 C 30 s Elongation 72 C 1 min Plate read 80 C 8 s 45 Extension 72 C 10 min 1 Table 9: Program for qpcr of bacterial amoa genes Preglednica 9: qpcr program za bakterijski amoa gen Step Temperature Time Number of cycles Initial denaturation 95 C 5 min 1 Denaturation 95 C 15 s 45 Annealing with 60 C 1 min elongation Plate read 80 C 8 s 1
31 3.2.7 Statistical analysis Data acquired from molecular assays was statistically analysed to determine if nondependable variable (days of incubation and treatment) has a significant effect on dependable variable (amoa gene abundance). The analysis was done in IBM SPSS 20 program and two-way ANOVA statistical model was used. Normality of the data and homogeneity of variances were also checked to determine if two-way ANOVA could be performed. If not, data was first transformed and then analysed again. Bonferroni correction was also used to test the p-value.
32 4 RESULTS 4.1 SOIL ph MEASUREMENTS Only in microcosms amended with ammonium sulphate, decrease in ph was detected (Figure 11; Figure 12). The overall difference in ph value could be seen as the heterogenic properties of soils. a) b) 4,0 7,7 3,9 7,6 3,8 7,5 ph ph 3,7 7,4 3,6 7,3 3,5 0 5 10 15 20 25 30 35 7,2 0 5 10 15 20 25 30 35 Time (Days) Time (Days) Control microcosms Glutamate microcosms Ammonium sulphate microcosms Figure 11: ph of acidic soil (a) and ph of neutral soil (b) in microcosms amended with water ( ), glutamate ( ) or ammonium sulphate ( ) in experiment with single amendment. Data represent the means and standard error calculated from triplicate microcosms for each treatment Slika 11: ph meritve mikrokozmov za kisla tla pri poskusu z enkratnim dodajanjem dodatkov. Krivulje prikazujejo kontrolo ( ), dodatek glutamata ( ) in amonijevega sulfata ( ). Podatki predstavljajo srednje vrednosti in standardne napake izračunane iz treh ponovitev za vsak posamezen dodatek
33 8,4 8,2 8,0 ph 7,8 7,6 7,4 7,2 0 5 10 15 20 25 30 Time (Days) Control microcosms Glutamate microcosms Ammonium sulphate microcosms Figure 12: ph measurements in neutral soil microcosms with repeated amendment. Each line represents different amendment: control ( ), glutamate ( ) or ammonium sulphate ( ). Data represent the means and standard error calculated from triplicate microcosms for each treatment Slika 12: ph meritve mikrokozmov za nevtralna tla pri poskusu z večkratnim dodajanjem dodatkov. Krivulje prikazujejo kontrolo ( ), dodatek glutamata ( ) in amonijevega sulfata ( ). Podatki predstavljajo srednje vrednosti in standardne napake izračunane iz treh ponovitev za vsak posamezen dodatek 4.2 INFLUENCE OF AMMONIUM SOURCE ON NITRIFICATION RATE Nitrification kinetics was measured in soil microcosms amended with two sources of ammonium: glutamate and ammonium sulphate. 4.2.1 Experiment with single amendment In this experiment, glutamate or ammonium sulphate was added to soils only once after construction of microcosms. In acidic soil microcosms amended with ammonium sulphate the concentration of mineral ammonium in soil decreased to 90 µg NH + 4 -N g -1 dry soil at day 4 and then increased slowly to a final concentration of 130 µg NH + 4 -N g -1 dry soil. A different pattern was observed for glutamate-amended microcosms where NH + 4 -N dropped to levels comparable to those in control microcosms after incubation for only 7 days (Figure 14a). Nitrification kinetic, expressed as accumulation of nitrate g -1 soil day -1 was highest (16 µg (NO - 2 +NO - 3 )-N g -1 dry soil day -1 ) in microcosms amended with glutamate (Table 10).
34 In neutral soil microcosms ammonium decreased to concentrations comparable to those measured in control microcosms after incubation for only 4 days regardless of whether ammonium amendment was organic or inorganic (Figure 15a). The nitrification kinetics were similar for both treatments (Figure 15b), with highest nitrification speed in ammonium sulphate amended microcosms (40 µg (NO - 2 +NO - 3 )-N g -1 dry soil day -1 ) during - the first 4 days of incubation. The control microcosms showed the slowest rate 5 µg (NO 2 +NO - 3 )-N g -1 dry soil day -1. After day 4, the nitrification rate for all three microcosms was constant (8 µg (NO - 2 +NO - 3 )-N g -1 dry soil) (Table 10). Microcosms amended with ammonium sulphate had the highest concentration of (NO - 2 +NO - 3 )-N after 30 days, namely 270 ± 6 µg (NO - 2 +NO - 3 )-N g -1 dry soil. (a) 180 (b) 600 µg NH4+-N g-1 dry soil 160 140 120 100 80 60 40 20 0 µg (NO2- + NO3-)-N g-1 dry soil 500 400 300 200 100 0 0 5 10 15 20 25 30 35 Time (Days) 0 5 10 15 20 25 30 35 Time (Days) Control microcosms Glutamate microcosms Ammonium sulphate microcosms Figure 14: Accumulation of NH 4 + -N g -1 dry soil (a) and (NO 2 - +NO 3 - )-N g -1 dry soil (b) in experiment with single amendment during incubation of microcosms with acidic soil amended with glutamate or ammonium sulphate. Each line represents different amendment: control ( ), glutamate ( ) or ammonium sulphate ( ). Data represent the means and standard error calculated from triplicate microcosms for each treatment Slika 14: Koncentracije NH 4 + -N g -1 suhih tal (a) in (NO 2 - +NO 3 - )-N g -1 suhih tal (b) v talnih mikrokozmih (kisla tla), obogatenih z glutamatom ali amonijevim sulfatom pri poskusu z enkratnim dodajanjem dodatkov. Krivulje prikazujejo kontrolo ( ), dodatek glutamata ( ) in amonijevega sulfata ( ). Podatki predstavljajo srednje vrednosti in standardne napake izračunane iz treh ponovitev za vsak posamezen dodatek
35 (a) (b) 180 300 µg NH4+-N g-1 dry soil 160 140 120 100 80 60 40 20 0 µg (NO2- + NO3-)-N g-1 dry soil 250 200 150 100 50 0 0 5 10 15 20 25 30 35 Time (Days) 0 5 10 15 20 25 30 35 Time (Days) Control microcosms Glutamate microcosms Ammonium sulphate microcosms Figure 15: Accumulation of NH 4 + -N g -1 dry soil (a) and (NO 2 - +NO 3 - )-N g -1 dry soil (b) during incubation in experiment with single amendment in microcosms with neutral soil amended with glutamate or ammonium sulphate. Each line represents different amendment: control ( ), glutamate ( ) or ammonium sulphate ( ). Data represent the means and standard error calculated from triplicate microcosms for each treatment Slika 15: Koncentracije NH4 + -N g -1 suhih tal (a) in (NO 2 - +NO 3 - )-N g -1 suhih tal (b) v talnih mikrokozmih (nevtralna tla), obogatenih z glutamatom ali amonijevim sulfatom v poskusu z enkratnim dodajanjem dodatkov. Krivulje prikazujejo kontrolo ( ), dodatek glutamata ( ) in amonijevega sulfata ( ). Podatki predstavljajo srednje vrednosti in standardne napake izračunane iz treh ponovitev za vsak posamezen dodatek 4.2.2 Experiment with repeated amendment of ammonium sources In neutral soil, a similar response in NH 4 + - N concentration was observed in experiment with repeated amendment as in the experiment with single amendment. The nitrification rate was constant for the first 18 days with the highest nitrification rate of 35 µg (NO 2 - +NO 3 - )-N g -1 dry soil day -1 in glutamate amended microcosms. Subsequently, nitrification rate increased sharply for both glutamate and ammonium sulphate treatments and the nitrification rates were 172 µg and 197 µg (NO 2 - +NO 3 - )-N g -1 dry soil day -1 for ammonium sulphate and glutamate treatments, respectively. In contrast, nitrification rates in unamended controls were low throughout the incubation (Table 10).
36 (a) (b) 160 2000 140 µg NH4+-N g-1 dry soil 120 100 80 60 40 20 µg (NO2- + NO3-)-N g-1 dry soil 1500 1000 500 0 0 0 5 10 15 20 25 30 Time (Days) 0 5 10 15 20 25 30 Time (Days) Control microcosms Glutamate microcosms Ammonium sulphate microcosms Figure 16: Accumulation of NH 4 + -N g -1 dry soil (a) and (NO 2 - +NO 3 - )-N g -1 dry soil (b) during incubation in microcosms with neutral soil that was repeatedly amended with glutamate or ammonium sulphate. Repeated amendments were done after incubation for 0, 4, 6, 11, 16, 18 and 21 days. Each line represents different amendment: control ( ), glutamate ( ) or ammonium sulphate ( ). Data represent the means and standard error calculated from triplicate microcosms for each treatment Slika 16: Koncentracije NH4+-N g -1 suhih tal (a) in (NO 2 - +NO 3 - )-N g -1 suhih tal (b) v talnih mikrokozmih (nevtralna tla), obogatenih z glutamatom ali amonijevim sulfatom. Dodatki so bili dodani mikrokozmom večkrat in sicer ob dnevih 0, 4, 6, 11, 16, 18 in 21. Krivulje prikazujejo kontrolo ( ), dodatek glutamata ( ) in amonijevega sulfata ( ). Podatki predstavljajo srednje vrednosti in standardne napake izračunane iz treh ponovitev za vsak posamezen dodatek
37 Table 10: Nitrification rates calculated from (NO 2 - +NO 3 - )-N g -1 dry soil -1 concentrations, assuming that the nitrification rate is linear Preglednica 10: Hitrost nitrifikacije preračunana iz koncentracije (NO - 2 +NO - 3 )-N g -1 predpostavimo, da je hitrost nitrifikacije linearna Experiment with repeated amendment Experiment with single amendment Experiment with single amendment Neutral soil Neutral soil Acidic soil Initial nitrification rate (NO 2 - +NO 3 - )-N g -1 dry soil day -1 Late nitrification rate (NO 2 - +NO 3 - )-N g -1 dry soil day -1 suhih tal -1, če Average nitrification rate (NO 2 - +NO 3 - )-N g -1 dry soil day -1 Control 3 4 4 Ammonium sulphate 41 197 75 Glutamate 30 172 70 Control 4 5 5 Ammonium sulphate 40 3 8 Glutamate 30 5 8 Control 11 10 10 Ammonium sulphate 17 8 11 Glutamate 18 15 16 In control microcosms, the (NO - 2 +NO - 3 )-N concentration was higher in acidic soil in comparison with neutral soil in experiment with single amendment as well as in experiment with repeated amendment (Figure 13a). In ammonium sulphate amended microcosms in experiment with single amendment, the initial nitrification rate was higher in neutral soil, but average nitrification rate was higher in acidic soil (Figure 13b; Table 10). Noticeable difference in nitrification kinetics was observed in experiment with repeated amendment. At day 6 (NO - 2 +NO - 3 )-N concentration was comparable to final concentration in experiment with single amendment (300 µg (NO - 2 +NO - 3 )-N g -1 dry soil). It was also noticeable, that late nitrification rate was much higher from the initial nitrification rate, which was not observed in the experiment with single amendment. In glutamate amended microcosms in experiment with single amendment, (NO - 2 +NO - 3 )-N concentration was similar for both soils until day 10. Afterwards nitrification rate was
38 again higher in acidic soil than in neutral soil for both experiments. In experiment with repeated amendment, nitrification kinetics is similar to that in ammonium sulphate amended microcosms. a) 2000 1500 (NO 2 - +NO3 - )-N g -1 dry soil 1000 500 0 0 5 10 15 20 25 30 35 b) c) 2000 2000 (NO 2 - +NO3 - )-N g -1 dry soil 1500 1000 500 (NO 2 - +NO3 - )-N g -1 dry soil 1500 1000 500 0 0 0 5 10 15 20 25 30 35 Time (Days) 0 5 10 15 20 25 30 35 Time (Days) Acidic soil in experiment with single amendment Neutral soil in experiment with single amendment Neutral soil in experiment with repeated amendment Figure 13: Accumulation of (NO - 2 +NO - 3 )-N g -1 dry soil in control microcosms (a), microcosms amended with ammonium sulphate (b) and microcosms amended with glutamate (c). Each line represents: acidic soil in experiment with single amendment ( ), neutral soil in experiment with single amendment ( ) and neutral soil in experiment with repeated amendment ( ). Data represent the means and standard error calculated from triplicate microcosms for each treatment Slika 13: Koncentracije (NO2-+NO3-)-N g -1 suhih tal v talnih kontrolnih mikrokozmih (a), mikrokozmih z amonijevim sulfatom (b) in mikrokozmih obogatenih z glutamatom (c). Krivulje prikazujejo kisla tla v poskusu s posameznim dodajanjem dodatkov ( ), nevtralna tla pri poskusu s posameznim dodajanjem dodatkov ( ) in nevtralna tla pri poskusu z večkratnim dodajanjem dodatkov ( ). Podatki predstavljajo srednje vrednosti in standardne napake izračunane iz treh ponovitev za vsak posamezen dodatek
39 4.4 ANALYSIS OF amoa GENE ABUNDANCE IN SOIL MICROCOSMS The abundance of the specific amoa genes was determined to assess whether different treatments (glutamate and ammonium sulphate) influenced the abundance of AOA and AOB. In acidic soil, bacterial amoa gene was below the level of detection. In contrast abundance of AOA amoa was high, reaching 10 7 gene copies g -1 dry soil. There was no statistically significant difference between treatments and time points in AOA amoa gene abundance (p > 0.05) (if p-value was more than 0.05 it could be assumed that null hypothesis was not rejected and there was no significant effect of non-dependable variables to dependant variable), but there was a noticeable trend of decreasing AOA amoa gene abundance (Figure 17). Similarly, in neutral soil there was no statistically significant difference in AOA amoa gene abundance between treatments and time points (p > 0.05) (Figure 18a). Two-way ANOVA showed no significant difference between time points and treatments in AOB amoa gene abundance (p > 0.05). Furthermore no trend of increase or decrease could be determined because of amoa gene abundance variation. However it is noticeable that AOB amoa gene abundance was ten-times higher than AOA amoa gene abundance. Even though two-way ANOVA showed no statistical difference between time points and treatments (p > 0.05), some trend of increase could be observed in both AOA and AOB amoa gene abundance. However AOB amoa gene abundance (Figure 19b) in microcosms repeatedly amended with glutamate indicated the highest gene abundance after 24 days.
40 2,5e+7 Archaeal amoa gene abundance 2,0e+7 1,5e+7 1,0e+7 5,0e+6 0,0 0 10 20 30 Time (Days) Control microcosms Glutamate microcosms Ammonium sulphate microcosms Figure 17: AOA amoa gene abundance in acidic soil in experiment with single amendment for microcosms, amended with glutamate (red) or ammonium sulphate (green) or unamended control microcosms (black). Data represent the means and standard error calculated from triplicate microcosms for each treatment. IBM SPSS 20 program and two-way ANOVA statistical model were performed for the statistical analysis of these results Slika 17: Številčnost genov amoa AOA v talnih mikrokozmih pripravljenih s kislimi tlemi visokega barja in obogatenih z glutamatom (rdeči stolpci), amonijevim sulfatom (zeleni stolpci) in neobogatenimi kontrolni mikrokozmi (črni stolpci) v poskusu z enkratnim dodajanjem dodatkov. Posamezen stolpec predstavlja povprečno vrednost treh ponovitev. Podatki predstavljajo srednje vrednosti in standardne napake izračunane iz treh ponovitev za vsak posamezen dodatek
41 (a) (b) 2,5e+7 2e+8 Archaeal amoa gene abundance 2,0e+7 1,5e+7 1,0e+7 5,0e+6 Bacterial amoa gene abundance 2e+8 1e+8 5e+7 0,0 0 10 20 30 0 0 10 20 30 Time (Days) Time (Days) Control microcosms Glutamate microcosms Ammonium sulphate microcosms Figure 18: amoa gene abundance in neutral soil in experiment with single amendment for microcosms, amended with glutamate (red) or ammonium sulphate (green) or unamended control microcosms (black). Results are showed for AOA amoa gene abundance (a) and AOB amoa gene abundance (b). Data represent the means and standard error calculated from triplicate microcosms for each treatment. IBM SPSS 20 program and two-way ANOVA statistical model were performed for the statistical analysis of these results Slika 18: Številčnost amoa genov v talnih mikrokozmih pripravljenih z nevtralnimi tlemi obogatenih z glutamatom (rdeči stolpci), amonijevim sulfatom (zeleni stolpci) in neobogatenimi kontrolni mikrokozmi (črni stolpci) v poskusu z enkratnim dodajanjem dodatkov. Rezultati prikazujejo število AOA amoa genov (a) in AOB amoa genov (b). Posamezen stolpec predstavlja povprečno vrednost treh ponovitev. Podatki predstavljajo srednje vrednosti in standardne napake izračunane iz treh ponovitev za vsak posamezen dodatek
42 (a) 4e+7 (b) 1,6e+8 1,4e+8 Archaeal amoa gene abundance 3e+7 2e+7 1e+7 Bacterial amoa gene abundance 1,2e+8 1,0e+8 8,0e+7 6,0e+7 4,0e+7 2,0e+7 0 0 9 18 24 0,0 0 9 18 24 Time (Days) Time (Days) Control microcosms Glutamate microcosms Ammonium sulphate microcosms Figure 19: amoa gene abundance in neutral soil for microcosm experiment with repeated amendment of glutamate (red) or ammonium sulphate (green) or unamended control microcosms (black). Results are showed for AOA amoa gene abundance (a) and AOB amoa gene abundance (b). Data represent the means and standard error calculated from triplicate microcosms for each treatment. IBM SPSS 20 program and two-way ANOVA statistical model were performed for the statistical analysis of these results. Slika 19: Številčnost amoa genov v talnih mikrokozmih pripravljenih z nevtralnimi tlemi, večkratno obogatenih z glutamatom (rdeči stolpci), amonijevim sulfatom (zeleni stolpci) in neobogatenimi kontrolni mikrokozmi (črni stolpci). Rezultati prikazujejo število AOA amoa genov (a) in AOB amoa genov (b). Posamezen stolpec predstavlja povprečno vrednost treh ponovitev. Podatki predstavljajo srednje vrednosti in standardne napake izračunane iz treh ponovitev za vsak posamezen dodatek.
43 4.5 DGGE ANALYSIS DGGE analysis was performed to determine structural changes in AOA and AOB microbial communities following amendment of soil microcosms with glutamate or ammonium sulphate. The results indicated that in acidic soil in the experiment with single amendment communities did not respond to either amendment but some temporal changes were observed in archaeal 16S rrna gene profiles. After incubation for 30 days, two bands showed increased relative intensity, while relative intensity of other bands decreased (figure 20a). Furthermore, changes in relative band intensity between time point 0 and 30 were also observed for AOA amoa gene with one band becoming almost invisible (Figure 20b). In neutral soil in the experiment with single amendment, two bands in bacterial 16S rrna gene profiles became more intense after 30 days of incubation (Figure 20c). There were no differences in intensity of the bands between treatments or time points in any of the DGGE gels for the experiment with repeated amendments.
44 a) Control Glutamate Ammonium sulphate Control Glutamate Ammonium sulphate Day 0 Day 30 b) Control Glutamate Ammonium sulphate Control Glutamate Ammonium sulphate c) Control Day 0 Day 30 Ammonium Ammonium Glutamate Control Glutamate sulphate sulphate Day 0 Day 30 Figure 20: DGGE gels of AOA 16S rrna gene in acidic soil microcosms (a); thaumarchaeal amoa gene in acidic soil microcosms (b) and bacterial 16S rrna gene in neutral soil microcosms (c) in experiment with single amendment Slika 20: DGGE geli mikrokozemskega poskusa z enkratnim dodajanjem dodatkov za arhejski gen za 16S rrnk v kislih tleh (a), arhejski amoa gen v kislih tleh (b) in bakterijski gen za 16S rrnk v nevtralnih tleh (c)